EST details — SGN-E375749

Search information 
Request: 375749Match: SGN-E375749
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180987Clone name: TUS-35-M17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180987 is on microarray TOM1 spot ID 1-1-8.1.17.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C36402 [cLEG-38-J22] Trace: SGN-T71321 EST: SGN-E256625 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375749Length: 221 bp (1018 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E375749 [] (trimmed) CCGAATTTAGGGTTCCTCCCGATCTGAGCAACCAAAAGTCAACAAATTTTTTTTTTCAAACTTCTCTCAGATTTAGGGGCTTTGGAGTTTTTTCT
ATTTCTTGATTTAGCGCTAGAATTAGGATTTTAGTTTATGTGTTCTCAGTGAAGCGGCGAAGCTTTTGTTAGGGCACTGTAAAGCGGGTAATCGG
ATCTGCCAATGCAAATTGAATTGAAATCTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375749] SGN-U585316 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187517 [Download][View] Facility Assigned ID: FA0AAD23AG09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0304 Quality Trim Threshold: 14.5