EST details — SGN-E376112

Search information 
Request: 376112Match: SGN-E376112
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185745Clone name: TUS-48-C23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185745 is on microarray TOM1 spot ID 1-1-2.3.7.12 [Order] [Tomato Microarray Database]
See unigene SGN-U570976 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C185745 [TUS-48-C23] Trace: SGN-T1898 EST: SGN-E378482 Direction: 5' Facility: Giov. Lab
Clone: SGN-C185745 [TUS-48-C23] Trace: SGN-T188153 EST: SGN-E376113 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376112Length: 450 bp (870 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E376112 [] (trimmed) GGGTTCAACAATACCCTAAATCTATTTAGGTCCAAACAAAAACAATAAGTTTGAGCTAACTCATGTATTCATAAAATTGAATGAACTCATTTTTT
TTTTAACAAGCAACAGCAATTTTTTCGGCAACTTGGTCAAAATCCCGCTGACCACTGGATGTGATCCTCCTTCCGCCCTTAGGCTCAAAGTCAAT
GATGTTCATGTTCTGCAACTGTTGAAAAATGTGGCGTGCAACTGAACCACTGCTTTTGCAAAAGTGACGTGGACGGTTTCCATTTCTCTGGTTTC
CACCATAAATTCTTCGGAAACCACCAACACCAATACCTTCTTTCAAATAGATTTTCCTTGCCATGGAGGCAGTTTTGATGTACTACCAATCAGCA
TCATATGGGGCAAGCTTCCTTTAGTTTACCAGTCTTAATTATATCAGTCCATTCAGGAAGCTCCATTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376112] SGN-U570976 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T188152 [Download][View] Facility Assigned ID: FA0AAD36AB12FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0