EST details — SGN-E376390

Search information 
Request: 376390Match: SGN-E376390
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185882Clone name: TUS-48-I16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185882 is on microarray TOM1 spot ID 1-1-1.1.7.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15034 [cLED-10-D12] Trace: SGN-T51258 EST: SGN-E231407 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376390Length: 242 bp (935 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E376390 [] (trimmed) ATGTCTACATTGGGGGTTCAAATGCTGATGTCAACAAGAAACTCAGTGCTCCAATCGCTGACATACTTGAGACTAAATTGTCTATTCCCAAATCT
CGATTTTTCCTGAAATTCTATGGTACTAAGGGTTCCTTCTTTGGCTGGAATGGATCTACCTTCTGAATTTCCATTTCATTTCACAATTGGCCATC
TTTGAGCCACTTATAAACTGTATGTATGTGGTTGGATCTGTATCTCTCACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376390] SGN-U581359 Tomato 200607 Build 2 48 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T188430 [Download][View] Facility Assigned ID: FA0AAD36BE08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0176 Quality Trim Threshold: 14.5