EST details — SGN-E376466

Search information 
Request: 376466Match: SGN-E376466
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C173989Clone name: TUS-17-J3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173989 is on microarray TOM1 spot ID 1-1-6.2.18.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6520 [cLEC-35-L10] Trace: SGN-T30913 EST: SGN-E210565 Direction: 5' Facility: TIGR
Clone: SGN-C173989 [TUS-17-J3] Trace: SGN-T189079 EST: SGN-E376465 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376466Length: 295 bp (931 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E376466 [] (trimmed) GAAATGTTTGTGTCCCATGTTCGTAGAAAGCAGATTCCCCCTTGTATTCTATCAGATGGTTATAAACGAAACCAAACACCAAGGCTAATGAGTGG
GCAGCTGGGAGAGAAGCCTGTCACTAGTATTTTTAGGTCAAGATCCAGAGAAAGAGGAGGTTTGGAAAGGAAAAGAGAGCTTGAATGTGTGGAAG
AGAGTCACCAGAGTTTGGACAAAAGACCATCAATTAGCCCTCCAAGAAGGGAATCACCTTCGCCTGAACTTATTGTTGGTGAGAAAAGTGGCATG
TTGTTACCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376466] SGN-U573535 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T189080 [Download][View] Facility Assigned ID: FA0AAD5CE02RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5