Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E377846

Search information 
Request: 377846Match: SGN-E377846
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175577Clone name: TUS-21-L7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175577 is on microarray TOM1 spot ID 1-1-2.4.13.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15518 [cLED-13-C4] Trace: SGN-T51647 EST: SGN-E236369 Direction: 5' Facility: TIGR
Clone: SGN-C175577 [TUS-21-L7] Trace: SGN-T190609 EST: SGN-E377847 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377846Length: 558 bp (923 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E377846 [] (trimmed) AAAACTCAAGTATATATTCCATTGGATAAAATGAATTTTTCACTTTGTTCTCCAAGGACTCGATTCAAGCTTCAAATCAATTAAATATCTAATAA
TACATTGGTGCAGGGAAAAACTAATATGTAGGATAAAAAATTCTAAAAAGCACACACTGGGTAGTTAATTATTTTATAATTATGCTGGTACTATG
CCAATCTTTTGATACTTTGCAACGTCTTCAGTGGAATGATCAAATGATCCAAGCCTGGTAGAGTTAACATAATCCTGAGGACAATGAGCAGGCAT
GCCTGGGAATAGCAAGCCAATCACTCTCATGCATAAAAAAAGCCCGCCTTCCTGATACTTTCGTCCGTGTACACATGGTAAAATACAGCTTCTGA
TCAGCTCCCAAGCTGCGTTTAACATCTTTGGTATAAACATTAACAGAAACGACCCATTCTTGTCTGGTTCTTCAACTAAAATTTTTTCTCTGTAG
AGGCTATTGTAATAAATGCAAGTTCCAAAGTGCTTGAACAAGAAAGTAGAATTGTCAAATGGCAATCTTGGTACCATGTCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377846] SGN-U575841 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190608 [Download][View] Facility Assigned ID: FA0AAD9CF04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5