EST details — SGN-E377875

Search information 
Request: 377875Match: SGN-E377875
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174954Clone name: TUS-20-B8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174954 is on microarray TOM1 spot ID 1-1-1.2.14.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23788 [cLED-6-F23] Trace: SGN-T49977 EST: SGN-E232991 Direction: 5' Facility: TIGR
Clone: SGN-C174954 [TUS-20-B8] Trace: SGN-T190096 EST: SGN-E377874 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377875Length: 388 bp (922 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E377875 [] (trimmed) CGCCTACGTCACCATTTAATATTTCTTGGCCTACTATTGGCCAAACCACCTGGGCACTAGGCCCAATGTGAGTTGGATCACTTAGCCACGCTTCA
TAATTAGAAAAACGAGCACCGTGGAAATACATGCCGCTCAGCCAAAGAAAGATGATGGAGAGTTGACCGAAATGTGCACTAAATACTTTTCGAGA
GATCTCCTCCAAATCACTGGTATGGCTATCGAAATCGTGAGCATCAGCATGTAGGTTCCAGATCCAAGTGGTAGTATCAGGCCCTTTAGCTATTG
TTCTTGAGAAATGACCCGGTCTGGCCCATTCCTCGAAAGAAGTTTTTACGGGATCCCTATCTACCAAAATTTTAACTTCTGGTTCCGGCGAACGA
ATAATCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377875] SGN-U581403 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190097 [Download][View] Facility Assigned ID: FA0AAD8DA04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5