EST details — SGN-E377987

Search information 
Request: 377987Match: SGN-E377987
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175158Clone name: TUS-20-J20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175158 is on microarray TOM1 spot ID 1-1-5.2.13.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C24021 [cLED-6-P3] Trace: SGN-T49992 EST: SGN-E233006 Direction: 5' Facility: TIGR
Clone: SGN-C175158 [TUS-20-J20] Trace: SGN-T190210 EST: SGN-E377988 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377987Length: 663 bp (922 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E377987 [] (trimmed) AACGGGGAAAAAAGGACATGTCTTTATTAATATTTTTCTCCATAAAGATCCTTAAGTACTTGAAATGTACTTGGTTACTTTATACAAATGCCTAA
TACACCACAAAACAAATAGGAGTAAGTAGTAACTTTTTTCTCTCTCTCTCTCTCTCTCATGAACTCAAAAGAAATAATATGATTGATCATATGAT
ATAATTTAAAAGGCTCCTTCAACTCAACAACTTTTTTAAAAAAAAAGTAAAAACTTTTTGGTCTCCAAAAAAGTTTCAACTAATTAAAATGTTGT
TGCTCTAGCCATGGCCAAAAACTTGTTTGATCATCAATTCCACAAAACATGTTGGATAGGCTTTCTTCTTTGACACTACTACTATTATTAGTAGT
AGTATTTTGGTCCATTAATTTGAGATCTTGTCTTGATGATGATGAATTGATGTGAAAGAGTTGATGAGGTACCACAACCCCATTATTATTATTAT
TATTATTAGACCTTATCATTGAAGGTGGAAAAAAAGGTCTACTAGAAATATTTGGATGATGATTGGATAATGGGCTGTCAATGGCTGGTGTTCTT
GATATGTCTAGCTTTATTTCTGAGCTGTTTTCACTTCTATTGCTGCATGATCCTTCTGTTTCCTTGTTCAAATTGATTGAATTTGGTGGTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377987] SGN-U569793 Tomato 200607 Build 2 42 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190209 [Download][View] Facility Assigned ID: FA0AAD8DE10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0