EST details — SGN-E378165
| Search information |
| Request: 378165 | Match: SGN-E378165 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C176076 | Clone name: TUS-23-A2 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C176076 is on microarray TOM1 spot ID 1-1-7.1.11.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C18847 [cLED-24-M12] | Trace: SGN-T54849 | EST: SGN-E240952 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C176076 [TUS-23-A2] | Trace: SGN-T181182 | EST: SGN-E369144 | Direction: 5' | Facility: INRA |
| Clone: SGN-C176076 [TUS-23-A2] | Trace: SGN-T181259 | EST: SGN-E369221 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E378165 | Length: 187 bp (1145 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E378165 [] (trimmed)
AAAAAAAACCCCCCGGGACCAATATTTTTTGTTTCAAGGGGAAAAAAAGGGGGCCCCTAAATTTTGAACCCAAAAAGGCCCTTTCAATTTTCCCA
ACCCCCCTTTTCTTCCCCCCTATAAAAGTCGGGGGGAAACCCCCTTTTTTTCCCGCAAAAAAAGCCCCCCCCCCTTCCCCCCCCAAAACCTG
ACCCCCCTTTTCTTCCCCCCTATAAAAGTCGGGGGGAAACCCCCTTTTTTTCCCGCAAAAAAAGCCCCCCCCCCTTCCCCCCCCAAAACCTG
| Unigenes |
| Current Unigene builds | |||||
| No current unigene builds incorporate this sequence |
| Chromatogram |
| SGN-ID: SGN-T1386 [Download][View] | Facility Assigned ID: TUS23A2.ab1 |
| Submitter: Koni | Sequencing Facility: Giov. Lab |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.807 | Expected Error Rate: 0.0394 | Quality Trim Threshold: 14.5 |
Working
