EST details — SGN-E378225

Search information 
Request: 378225Match: SGN-E378225
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184141Clone name: TUS-44-A3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184141 is on microarray TOM1 spot ID 1-1-6.1.16.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23616 [cLED-5-O12] Trace: SGN-T49641 EST: SGN-E231025 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378225Length: 332 bp (1070 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378225 [] (trimmed) TATGCAGGATCAGCGCAGCGGCAGCACCAGCACCTTGAAGCGAATCTGGTGAAGGGACGCCAAGGAGAACGCATTAGGCTCTACGTTAGAGGGAC
TGTTCTTGGATACAAAAGGTCGAAATCGAACCAGTATCCCAACACTTCGTTGATTCAGATCGAGGGAGTGAACACTAAGGAAGAAGTGGACTGGT
ACCTTGGGAAGAGGCTGGGATACATCTANCAGGCAAAGACAAAGAAGAATAACTCGCACTATCGTTGCATTTGGGGCAAGTTTGCAGGCCACATG
GAAACAGTGGCGTTGTTAGAGCTAAGTTCAGTCCAATTTGCCTCCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378225] SGN-U578165 Tomato 200607 Build 2 98 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1817 [Download][View] Facility Assigned ID: TUS44A3.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0187 Quality Trim Threshold: 14.5