Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E378234

Search information 
Request: 378234Match: SGN-E378234
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185012Clone name: TUS-46-E10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185012 is on microarray TOM1 spot ID 1-1-7.1.12.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C18859 [cLED-24-M23] Trace: SGN-T54813 EST: SGN-E240916 Direction: 5' Facility: TIGR
Clone: SGN-C185012 [TUS-46-E10] Trace: SGN-T196579 EST: SGN-E395253 Direction: 5' Facility: INRA
Clone: SGN-C185012 [TUS-46-E10] Trace: SGN-T200092 EST: SGN-E398766 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378234Length: 303 bp (1101 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378234 [] (trimmed) CAGCAAAAACTGGAGTGAAATCAGCCGTGGCTCCAATTCAAAGCTTTTCACATGAGAACATGTCGAATAATCCTGCTCCGGTGCATTACTGTCAA
CCATCGCAATATGTTAGAGAACAGAAGGCGGAAGATGGATATAATTGGAGGAAATATGGACAAAAGCAAGTGAGAGGAAGTGAAAATCCGCGAAG
TTATTACAAGTGTACATTTCCAAATTGTCCTACAAAGAAGAAGGTTGAAGGGAACTTGGATGGACACATTACTGAGATAGTTTATAAGGGGAGTC
ATAATCATCCCAAACCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378234] SGN-U577212 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1860 [Download][View] Facility Assigned ID: TUS46E10.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0117 Quality Trim Threshold: 20.5