EST details — SGN-E378288

Search information 
Request: 378288Match: SGN-E378288
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179497Clone name: TUS-31-O15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179497 is on microarray TOM1 spot ID 1-1-2.3.2.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179497 [TUS-31-O15] Trace: SGN-T185081 EST: SGN-E372624 Direction: 3' Facility: INRA
Clone: SGN-C179497 [TUS-31-O15] Trace: SGN-T185082 EST: SGN-E372625 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378288Length: 377 bp (1241 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378288 [] (trimmed) CCCAAGGGGGGAAAAACCGGAAAATTTCCAAACCCCCAAAAAAACCCTGGAGGGGTTTTTTTTTTCCCTTAAAAAAACACCCCCAAAAGGGGAAA
GGGGGGCCCTTTTTTCCAACCATTTCCCCAAAAGGGAAAGGGGGAGGGTTAAAAAAAAAAATTTCGGTTCCAAAAAAACCCCTTTCCCGGGCAAG
GGGGGATAACCCAAGGGAAAAAAGTTCCGGGGCCCCCCAGCAGGGTCCCCGGCCCCCCGCCGAAAGTTTCCAAAAACCAAAAAAAAAAAAAACCC
CCCCCCAAAGCGGGGAAAAAAAAAAAAAAGGACCCCCCCGCCTTTTCGGGGCCCCTAAAAACTTTAATTGCCCCCCCCCCCCCCCCCCCCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378288] SGN-U602002 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1533 [Download][View] Facility Assigned ID: TUS31O15.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.839 Expected Error Rate: 0.0283 Quality Trim Threshold: 14.5