EST details — SGN-E378463

Search information 
Request: 378463Match: SGN-E378463
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184331Clone name: TUS-44-I1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184331 is on microarray TOM1 spot ID 1-1-8.1.16.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15191 [cLED-11-D17] Trace: SGN-T51526 EST: SGN-E235516 Direction: 5' Facility: TIGR
Clone: SGN-C184331 [TUS-44-I1] Trace: SGN-T191890 EST: SGN-E390564 Direction: 5' Facility: INRA
Clone: SGN-C184331 [TUS-44-I1] Trace: SGN-T192124 EST: SGN-E390798 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378463Length: 345 bp (1138 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378463 [] (trimmed) CTGCGGAATTCGGAACCAGGAGAAGCTAGGAGAGGAAACATTACTATCCCCTGTATTTCAAAGGCCACAAGAAATTCTGAATAAGTTGAAGAATT
CATCGGATTTTGTGGATTCAAAAGATGGATCATCAGATAGTGATTCAAGTGGAGTGATGAATGAAGAAACTTACAACATTTCAACACTCAATTAT
CAACAATTAATGCCTAAAGTGTCATCTTACAGTAATTCCCTGGATCATCTGTCACTATCTTCATNCACATACACACAGTTTAATGGATCCAGGGG
CAAGTAATTCTACATCATCATCAATGAGAGCTTTATATAATAATATATTAATTATGATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378463] SGN-U579283 Tomato 200607 Build 2 53 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1824 [Download][View] Facility Assigned ID: TUS44I1.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0125 Quality Trim Threshold: 14.5