EST details — SGN-E378470

Search information 
Request: 378470Match: SGN-E378470
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185037Clone name: TUS-46-F11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185037 is on microarray TOM1 spot ID 1-1-6.2.12.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72230 [cLER-1-I6] Trace: SGN-T92111 EST: SGN-E280557 Direction: 5' Facility: TIGR
Clone: SGN-C185037 [TUS-46-F11] Trace: SGN-T199029 EST: SGN-E397703 Direction: 5' Facility: INRA
Clone: SGN-C185037 [TUS-46-F11] Trace: SGN-T199090 EST: SGN-E397764 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378470Length: 201 bp (1081 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378470 [] (trimmed) AANTAGATATGAATTCTGATAAGGAGTGTCTTGTTAATACAATACTTTCTTGTGACCAACTACAATCTTAATCCAGTATACTTCTGTAAAATCAT
TAAAGATCAACATAGAAAGGATGCTGCCTTCTCGACGTGGCAAGATTTACCTGAGCATTCCCAGAGATAAACTCAAAAGTTGCTTCATAAGCCCC
ACAAAGCTTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378470] SGN-U579558 Tomato 200607 Build 2 147 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1861 [Download][View] Facility Assigned ID: TUS46F11.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0032 Quality Trim Threshold: 20.5