EST details — SGN-E378478

Search information 
Request: 378478Match: SGN-E378478
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185274Clone name: TUS-46-P8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185274 is on microarray TOM1 spot ID 1-1-1.4.12.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C118388 [cTOB-12-P22] Trace: SGN-T131804 EST: SGN-E319937 Direction: 5' Facility: TIGR
Clone: SGN-C185274 [TUS-46-P8] Trace: SGN-T192042 EST: SGN-E390716 Direction: 5' Facility: INRA
Clone: SGN-C185274 [TUS-46-P8] Trace: SGN-T192284 EST: SGN-E390958 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378478Length: 354 bp (1131 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378478 [] (trimmed) CCCCCGGGCGGTTAGGGTTTCGGGAGCAGGCATTGGCTGCAGCATCAAAAACTGCCGATTTTCTCAAAATTGTTCATAGTTTGCATGCTTACTTC
CTTCTTATTGGAGATTCTGACATTCCAATCATATATCAAGTTTACCGTGTACGTGATGGAAAGAGCTTTGCTACACGAAGGGTGGATGCAATTCA
GAAAGGGAATATTGTATTCACATTGGTAGCTTCATTTCAGAAAGATGAAGATGGATTTGATCACCAGGAAGCAAAAATGCCTAATGTGCCTGATC
CAGAAACGCTTTTATCACTGGAAGATTTGAGAGAAATGCGCAAGACTGATCCTCGGCTTCCCAGGACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378478] SGN-U576975 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1886 [Download][View] Facility Assigned ID: TUS46P8.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0023 Quality Trim Threshold: 20.5