EST details — SGN-E378482

Search information 
Request: 378482Match: SGN-E378482
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185745Clone name: TUS-48-C23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185745 is on microarray TOM1 spot ID 1-1-2.3.7.12 [Order] [Tomato Microarray Database]
See unigene SGN-U570976 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C185745 [TUS-48-C23] Trace: SGN-T188152 EST: SGN-E376112 Direction: 3' Facility: INRA
Clone: SGN-C185745 [TUS-48-C23] Trace: SGN-T188153 EST: SGN-E376113 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378482Length: 305 bp (1138 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378482 [] (trimmed) ATGTTTCCTCCCATGATTTTCTCAAGGCTTATGCCGCTCATCTCAAGCGCTCCGGAAAGATGGAGCTTCCTGAATGGACTGATATAGTTAAGACT
GGTAAGCTAAAGGAGCTTGCCCCATATGATGCTGATTGGTACTACATCAGAGCTGCCTCCATGGCAAGGAAGATCTATTTGAGAGGAGGTATTGG
TGTTGGTGGTTTCCGAAGAATCTATGGTGGAACCAGAGGAATGGAAGCCGTCACGTCACTTTTGCAGAGCAGTGGTTCATTGCACGCACATTCTC
AACAGTTGCAGACATGACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378482] SGN-U570976 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1898 [Download][View] Facility Assigned ID: TUS48C23.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0021 Quality Trim Threshold: 20.5