EST details — SGN-E378483

Search information 
Request: 378483Match: SGN-E378483
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185725Clone name: TUS-48-C3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185725 is on microarray TOM1 spot ID 1-1-6.3.7.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185725 [TUS-48-C3] Trace: SGN-T188230 EST: SGN-E376190 Direction: 3' Facility: INRA
Clone: SGN-C185725 [TUS-48-C3] Trace: SGN-T188231 EST: SGN-E376191 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378483Length: 276 bp (1107 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378483 [] (trimmed) AGGTACATGACCAAATTTTGGATTATACAGACAGTGACAATACATAAGGCTCAATTGTGCGCTCACTCTTTATTTTATTTCTTCCCTCGAAGTTT
CGCTCCAAGAGCTCTCTCCAGTTTTGAGATTATTTGTTGGTTTGGAATTGCCTTTCCTGATTCGTATTCTTGGATGATCTGTGGCTTCTCATTTA
TCAATTGAGCAAGTTGAGACTGAGTCAGCTTTTTGTCTTGTCGTGCTTGCATGATAGCTTTCTTCAGTTCAGTTGGTACCTGCCCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378483] SGN-U563353 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1899 [Download][View] Facility Assigned ID: TUS48C3.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0