EST details — SGN-E378485

Search information 
Request: 378485Match: SGN-E378485
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185857Clone name: TUS-48-H15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185857 is on microarray TOM1 spot ID 1-1-2.4.7.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185857 [TUS-48-H15] Trace: SGN-T192721 EST: SGN-E391395 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378485Length: 307 bp (1160 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378485 [] (trimmed) GAAAGAATTTGCACATCAATGCACTCGCTTGTGAGAAGGAAGCTGTGAACGTTTCACTTGGAAATCTGCTTACGTATCCATTCGTGAGAGAAGGA
TTGGTGAAGAAAACATTGGCATTGAAGGGAGGTTACTATGATTTCGTGAAGGGTGGATTTGAGCTGTGGGGACTTGAGTTCGGTCTTTCTCCTCC
TCTTTCCGTATGAACTTAATTCAATTACCATTTGGCCCTCACATTTCCCTTCTTTTTTTTTTTTTTCCCCGGAAAATTCTTTTGGTTCCAAAAAT
CAACGGGGGGGAAGTTGTTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378485] SGN-U579509 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1905 [Download][View] Facility Assigned ID: TUS48H15.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0137 Quality Trim Threshold: 14.5