EST details — SGN-E378636

Search information 
Request: 378636Match: SGN-E378636
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184611Clone name: TUS-45-D17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184611 is on microarray TOM1 spot ID 1-1-8.4.14.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77158 [cLES-20-C12] Trace: SGN-T102203 EST: SGN-E290524 Direction: 5' Facility: TIGR
Clone: SGN-C184611 [TUS-45-D17] Trace: SGN-T198664 EST: SGN-E397338 Direction: 3' Facility: INRA
Clone: SGN-C184611 [TUS-45-D17] Trace: SGN-T198665 EST: SGN-E397339 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378636Length: 345 bp (1118 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378636 [] (trimmed) TCCCCCGGGTTCTCAGGGTTGTGCCAGATGAAGTGATAGAGGCACAATCAGACTCATACTGGNGCTCCTCACCCACAAACTGGGGTGTTTGGGCC
AGCAGATACTGCTGGCGCGGAACGTGGCTTTCACTCTTCACAAGCCACTGCTGCTACTGCTGAATCCATTTTGGAGCAGAAGGCGTTCTTCCGCC
CTCTTGAGGACTTGGAGAAGCCCATGCTTAATTAATTTCACGTACTCGAGTAAAATTGCTTTATGAACTATATATATATATATTGAGTACTAGTA
AAGCTGTTTGCTTGTGTTTGTGTTTATGCGAGTCAATAGTGTAGATTTAAGGTGCAGTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378636] SGN-U579297 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1839 [Download][View] Facility Assigned ID: TUS45D17.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0197 Quality Trim Threshold: 14.5