EST details — SGN-E378648

Search information 
Request: 378648Match: SGN-E378648
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185275Clone name: TUS-46-P9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185275 is on microarray TOM1 spot ID 1-1-8.4.12.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82323 [cLET-1-J20] Trace: SGN-T102519 EST: SGN-E292245 Direction: 5' Facility: TIGR
Clone: SGN-C185275 [TUS-46-P9] Trace: SGN-T199066 EST: SGN-E397740 Direction: 5' Facility: INRA
Clone: SGN-C185275 [TUS-46-P9] Trace: SGN-T199119 EST: SGN-E397793 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378648Length: 346 bp (1026 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378648 [] (trimmed) GAATTCGGCACCGACGGTGGTAACAGTAACGGTAACGGACATGCTAACGCTAACAGTAGCATTAGCGCTAGCGTCGGAGTTACGTCGTCGGAGGG
CGTGGGTTCAACAATCAGCCACCGTGATTTTGACTTGAACATTCCGGCGTTGCCGGAATTCTGGCCTGGATTTGGTTCCGGCGAAGATGAGGTGG
AGAGTCCACATCCGGCGAAGAAATCTCGGCTATCTCTACCTCCAAAATTTGAATTATTCCAACATTAATGTGACTTTAATTGATAGGATTTACGA
ATTTTGTAGACAAATTATATGGTAATTTTTTCTTTTCATGTGGGGGGGGATCAAAATTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378648] SGN-U578910 Tomato 200607 Build 2 68 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1887 [Download][View] Facility Assigned ID: TUS46P9.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5