EST details — SGN-E378719

Search information 
Request: 378719Match: SGN-E378719
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182605Clone name: TUS-40-A3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182605 is on microarray TOM1 spot ID 1-1-6.1.6.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C113154 [cTOA-1-I5] Trace: SGN-T124246 EST: SGN-E310323 Direction: 5' Facility: TIGR
Clone: SGN-C182605 [TUS-40-A3] Trace: SGN-T191783 EST: SGN-E390457 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378719Length: 420 bp (1124 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378719 [] (trimmed) GCGATCTACTGTTTCACCTCTGTCTTTGAATTCCAATATTTCTTTCGCCAATCGATCTGCTTCAGAGCATTCAGCAATCGATCGGCTTTAATCCA
GAATGGCTGCTGAGCCTACAAAAGAACATATTGATGTTGCTGAGACTGAACCTGTGGCATCATCTACTGATAATGAAGAAAAGACAAAAAAGAAG
AAAAAGAAGGGATTTTTTTCGATGATATGGAATAGTTTATTTAGGTCCAAAAAGGATGATTTTGAGAAGAGATTGCAGCATATTTCCAAGGAGGA
GGCTGCTGTTATTGCCAGAATCAATAAGCGATCCCAAAATTGGAGAAGGATGACAAGGCATCTCATTGTACTTTCTGTGATTTTTGAGGTTATTG
CAGTGGGTTATGCTATCATGACAACACGATCCCTTGAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378719] SGN-U581312 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1739 [Download][View] Facility Assigned ID: TUS40A3.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5