EST details — SGN-E378730

Search information 
Request: 378730Match: SGN-E378730
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184101Clone name: TUS-43-O11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184101 is on microarray TOM1 spot ID 1-1-6.3.18.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184101 [TUS-43-O11] Trace: SGN-T196655 EST: SGN-E395329 Direction: 3' Facility: INRA
Clone: SGN-C184101 [TUS-43-O11] Trace: SGN-T199758 EST: SGN-E398432 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378730Length: 286 bp (1091 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378730 [] (trimmed) AAAGAAGGTTCCAGCACCAAACCTCTCACAAGATGAACAGTACTTATATGGGCTCAAATCTCAATAGGAAAGAAAAGCTTGTTACTACTAGCATA
AAGTTTCAAAATTTGAATCTCAAAAAGGAATATCAATGAAGACTAAAATTCAGCAAAAGCAGATATGCCTTGACATCATTTCTAGATGTAAACAT
CAAAATAGAAACACTCAAGTTCACATTCCGGTAAAAGCTTTTTTCCCAACACCACCAGAACCGGCTGGAATCACCTTCAATACATTGAACCTCAC
A
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378730] SGN-U581429 Tomato 200607 Build 2 81 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1811 [Download][View] Facility Assigned ID: TUS43O11.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0060 Quality Trim Threshold: 20.5