Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E378811

Search information 
Request: 378811Match: SGN-E378811
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184988Clone name: TUS-46-D10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184988 is on microarray TOM1 spot ID 1-1-7.4.12.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80791 [cLET-13-G22] Trace: SGN-T105765 EST: SGN-E293922 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378811Length: 268 bp (1074 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378811 [] (trimmed) AATATATCTGGTTTTTTTCTTGTTGTTGTTGATCTAGACACGCAAAAGCAACCACTGTGGCATTATGGTTCAGGAGAAATATTATATGTCAATTA
GAATAATATTGTGCACAGTCTCATACAAGCCACTGAAGGATGAAATATCCAAATCATCATGGCGTANACTATTTGGATGAGGATGATGGCAAGCA
CAGTAATGAGCTCATTGAGCCTAAAGCCAACTTTCACTCTGGAGAAATATCAGTGAAAGGGCTCCATCACTTACTAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378811] SGN-U581090 Tomato 200607 Build 2 465 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1857 [Download][View] Facility Assigned ID: TUS46D10.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0126 Quality Trim Threshold: 14.5