EST details — SGN-E390690

Search information 
Request: 390690Match: SGN-E390690
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185096Clone name: TUS-46-H22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185096 is on microarray TOM1 spot ID 1-1-3.4.11.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90042 [cLEW-1-G8] Trace: SGN-T112088 EST: SGN-E299858 Direction: 5' Facility: TIGR
Clone: SGN-C185096 [TUS-46-H22] Trace: SGN-T192015 EST: SGN-E390689 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390690Length: 279 bp (849 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E390690 [] (trimmed) GAGAACTAGTGCCTTACCATTTTTTGTACAGGAATAGTACATCTACCAGCCATGGAATACCTGATTCCTGTTCATGTTCACAATTAGCTTGTGGA
GAGTCCAATTGTTGCCTTGAACAGTCTTGATTCAACCTGGTTAAACTAGACCCATTATAGATGTTACAGTGACAAGTGCTCTTTCCTTTTTTTTT
TCTTTCTTCAAATTACTAATGTTTCTTTTGTGCATCAAGATGGAGATATATTTCTGTATTTTGTAATGAAGATAATGTCCATTTTTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390690] SGN-U568791 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192016 [Download][View] Facility Assigned ID: FA0AAD34DD11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5