EST details — SGN-E390861

Search information 
Request: 390861Match: SGN-E390861
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185452Clone name: TUS-47-G18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185452 is on microarray TOM1 spot ID 1-1-7.3.9.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C78157 [cLES-4-K15] Trace: SGN-T97965 EST: SGN-E282224 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390861Length: 264 bp (874 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E390861 [] (trimmed) CTGCTGCACCCCACATGTTCACCAACGCCTACAAGAATGTGTTGGCCATTGCAATTGAAACCGACTACTCTTTCCCTCTCGCTGACAAAGTGAAG
GAATACCTCGCGGATCCAAGTAAGTTTGCCGCTGTTGCTGCCGCTCCTGCTGCAGCTGCTGGTTCTGGAGCTGCTCCTGCTGCTGCTAAAGAGGA
GGAGAAGAAGGAAGAGCCTGCTGAGGAGTCAGATGATGACATGGTTTTCAGTTTGTTTGAGTATTTCTCTTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390861] SGN-U578595 Tomato 200607 Build 2 75 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192187 [Download][View] Facility Assigned ID: FA0AAD35BD09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0026 Quality Trim Threshold: 14.5