Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E390866

Search information 
Request: 390866Match: SGN-E390866
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185500Clone name: TUS-47-I18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185500 is on microarray TOM1 spot ID 1-1-7.1.9.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C79330 [cLES-8-J14] Trace: SGN-T99117 EST: SGN-E288597 Direction: 5' Facility: TIGR
Clone: SGN-C185500 [TUS-47-I18] Trace: SGN-T191955 EST: SGN-E390629 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390866Length: 222 bp (969 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390866 [] (trimmed) AGTAAAGCATTAAATTCTTATTTCCACAAAGCATTCTTCATACGAAGTCTTATATTAGCGACTACAGATATATCAAAAACATTATTGGCATAGAT
TCTAGAAGCTCATTGTAGAGCCAGAACACTTGGGAGGCAGTAGTGATAAGCTTAAAGAGCATTGACGATTTCATCAGCGCCGGAGACCGTGAACT
CCCCTCCAGATTCATTGTTAACTACTTTCTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390866] SGN-U579086 Tomato 200607 Build 2 92 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192192 [Download][View] Facility Assigned ID: FA0AAD35BE09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0191 Quality Trim Threshold: 14.5