EST details — SGN-E390920
| Search information |
| Request: 390920 | Match: SGN-E390920 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C184982 | Clone name: TUS-46-D4 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C184982 is on microarray TOM1 spot ID 1-1-5.4.12.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C80259 [cLET-11-L16] | Trace: SGN-T105236 | EST: SGN-E292773 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C184982 [TUS-46-D4] | Trace: SGN-T197611 | EST: SGN-E396285 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E390920 | Length: 191 bp (886 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E390920 [] (trimmed)
ATAATATGATGATTAAACCCCTCAAACCTTCACATAACATCTTCCAAATGTTGTACAGCCTTCCTATGTTTCAATTTGTGAAGATGAACAGCCAA
TATCGCCTCGACGGAAAAAAAGATATATAAAAAATAGATTAAAAGAAATCAAGGTCAACATAATTGTCTTTTTTTTTTTTGGAAGAGAACAGTTC
C
TATCGCCTCGACGGAAAAAAAGATATATAAAAAATAGATTAAAAGAAATCAAGGTCAACATAATTGTCTTTTTTTTTTTTGGAAGAGAACAGTTC
C
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E390920] | SGN-U567367 | Tomato 200607 | Build 2 | 5 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T192246 [Download][View] | Facility Assigned ID: FA0AAD34DB02FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.920 | Expected Error Rate: 0.0191 | Quality Trim Threshold: 20.5 |
Working
