EST details — SGN-E390921

Search information 
Request: 390921Match: SGN-E390921
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184984Clone name: TUS-46-D6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184984 is on microarray TOM1 spot ID 1-1-3.4.12.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80365 [cLET-12-A1] Trace: SGN-T105644 EST: SGN-E293181 Direction: 5' Facility: TIGR
Clone: SGN-C184984 [TUS-46-D6] Trace: SGN-T191993 EST: SGN-E390667 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390921Length: 410 bp (859 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390921 [] (trimmed) GAAACACAAATTTGAGTTTATTGATACACTTACAACATGTTGTTCATCATTCATTCATCCTGGGAAGAGATGAACGAAAAACATTCTAAAAACAG
CACAAGCTGACCAAAACTAACTCGCATTAGCGTCTATGAAATGAATACAGTAATAGCAAACAAGCAAAACACACACTTCAGAAAAGTTTGTGTTC
TTATTGGATTTCAAGTAAAAACAGATATATCGATTACTATAAGTGCATCAATTTGAGAATTCAGTTTAGGGACTGAGTTACTGTGGTTTGTAGTC
GACGATAAGGAATTTCTCCAGCTGAGGAAGCAATGTATTTGCATATTCAACATGAACATGATGAGCTATATACTCTGCAACACCTTCTAAACTGT
CAAACGTAAACTCCAAAACATGAATGAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390921] SGN-U578281 Tomato 200607 Build 2 33 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192247 [Download][View] Facility Assigned ID: FA0AAD34DB03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0051 Quality Trim Threshold: 20.5