Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E391250

Search information 
Request: 391250Match: SGN-E391250
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C186041Clone name: TUS-48-P7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C186041 is on microarray TOM1 spot ID 1-1-2.4.7.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C75451 [cLES-14-C11] Trace: SGN-T100488 EST: SGN-E286667 Direction: 5' Facility: TIGR
Clone: SGN-C186041 [TUS-48-P7] Trace: SGN-T192817 EST: SGN-E391491 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391250Length: 238 bp (926 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E391250 [] (trimmed) CCGGGCAGGTGCCTGATGCATTGCCCTCTTCTGTCTGGCTACACCATCCCTTGGTCGAAGCGTCTCTTTTTTAGGTTGTTTGTAGTTGAAGGAGA
GTGATTGTGATGTTTTCTCCTCGTCTTTTCTCTCATTTTCTCCTTTTATCTGATTTTGCACTTTTGTGGTTCTTTTTTTTCTTGGACCCAATAAT
GTCAATATTTATTGAATGAGAAAATTCCTATATCATATCAGTTTGAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391250] SGN-U579208 Tomato 200607 Build 2 88 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192576 [Download][View] Facility Assigned ID: FA0AAD36CH04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.904 Expected Error Rate: 0.0084 Quality Trim Threshold: 12.5