EST details — SGN-E391289

Search information 
Request: 391289Match: SGN-E391289
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185469Clone name: TUS-47-H11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185469 is on microarray TOM1 spot ID 1-1-6.4.9.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C78638 [cLES-6-E6] Trace: SGN-T98424 EST: SGN-E286972 Direction: 5' Facility: TIGR
Clone: SGN-C185469 [TUS-47-H11] Trace: SGN-T192339 EST: SGN-E391013 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391289Length: 428 bp (851 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E391289 [] (trimmed) GAATACATTGTAGCACTGCCTCTGTCATGTGTTTACAAATGAGGAGGGTCTCCCTCCCCTTGCACAAAACATTTAAAGTATCCACAAAAGAAGAC
ATTATTTTCACTTCTGATCAGGATGAAACAAGAAGGATGGAATAAGCCTACTAGGAGTTGGTTGAAACTAAAACCTCACAAGTATCTTATCCTTG
TTTTTTACCAGTCATACCCGCAACACACATCGCTTAAAGGAGCTGCCGGAACTTGCTTGGATGATTCAAAAGAGTCCAGAATAGGCCTTACAACC
GCAGGAAGGAAGAGGCCGAATCCAGCGATGAGACAAGAGGCAGCCACGACTGGTTCTTGAACCACGAACATTCTCAATTTCCCCATTACCGCCAT
CTTTTTTTCTTCTTCTTCTTCCCGTAGATTTCCTACCACCCAGAAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391289] SGN-U574538 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192615 [Download][View] Facility Assigned ID: FA0AAD35CD06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0062 Quality Trim Threshold: 12.5