EST details — SGN-E392013
| Search information |
| Request: 392013 | Match: SGN-E392013 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C176710 | Clone name: TUS-24-K12 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C176710 is on microarray TOM1 spot ID 1-1-5.3.9.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C27679 [cLEF-45-C9] | Trace: SGN-T61231 | EST: SGN-E246496 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C176710 [TUS-24-K12] | Trace: SGN-T197847 | EST: SGN-E396521 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E392013 | Length: 135 bp (908 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E392013 [] (trimmed)
TCATATCTTTGATTGCATGTTAGTTCTTTGTATTTACATTATGAAATCTTGGAACTCCTAATTAAAACATAATATCAGTTGATGGATCATAATAT
CAGTTGATGGATCACAGTAAAGATGCTAAAGCATTTGACT
CAGTTGATGGATCACAGTAAAGATGCTAAAGCATTTGACT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E392013] | SGN-U574564 | Tomato 200607 | Build 2 | 7 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T193339 [Download][View] | Facility Assigned ID: FA0AAD12BF06FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.886 | Expected Error Rate: 0.0080 | Quality Trim Threshold: 14.5 |


