EST details — SGN-E392053

Search information 
Request: 392053Match: SGN-E392053
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176635Clone name: TUS-24-H9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176635 is on microarray TOM1 spot ID 1-1-8.4.9.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C27157 [cLEF-42-L19] Trace: SGN-T60800 EST: SGN-E247756 Direction: 5' Facility: TIGR
Clone: SGN-C176635 [TUS-24-H9] Trace: SGN-T193130 EST: SGN-E391804 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392053Length: 363 bp (869 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E392053 [] (trimmed) ATAAAAAAAACATATTTGAACCATTTGTAAAGGAAGGAAATATGTCTTCATTTTCAAAAACACAGGTTCTTCCCCAACACATTCCCACATTTTCC
CCCCCCCTGAAAAGGGAACTTCTTAACGTCAAAAACAGCGAAATCCAATACCAAATGTATACATAAAAAAACACAAAAAAAAAAACACCAAAATT
CTAGGAAAAATGTTATTAACCCCAATTTTGACCTTAACACAAAATGTTTTTATCTCAATGTAAGTTTTGCAAAGTTAACCCGCCCCGTTCCTTCC
CCCTTCAAGCTTTCATAGGACAAATTTCCTTCCCCCCTCCAAAAATTTATTAATTGATTCCCCCCTCATCCCCCAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392053] SGN-U589612 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193379 [Download][View] Facility Assigned ID: FA0AAD12CD05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.862 Expected Error Rate: 0.0171 Quality Trim Threshold: 14.5