EST details — SGN-E392058
| Search information |
| Request: 392058 | Match: SGN-E392058 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C176649 | Clone name: TUS-24-H23 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C176649 is on microarray TOM1 spot ID 1-1-2.4.9.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C27187 [cLEF-42-M7] | Trace: SGN-T60731 | EST: SGN-E247687 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C176649 [TUS-24-H23] | Trace: SGN-T1421 | EST: SGN-E378527 | Direction: 5' | Facility: Giov. Lab |
| Clone: SGN-C176649 [TUS-24-H23] | Trace: SGN-T193136 | EST: SGN-E391810 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E392058 | Length: 124 bp (815 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E392058 [] (trimmed)
CCCGCCCCAAAAAAAAAATAAAAAAAAAAGGGGGGGGAACCCCCAAAAATTTTTGGGGATTAAACCAAAAAAAAATCCCCCGAAGAAAAAAAAAA
AAATTTTTCCCCACAAAATTAAAAAAGGG
AAATTTTTCCCCACAAAATTAAAAAAGGG
| Unigenes |
| Current Unigene builds | |||||
| No current unigene builds incorporate this sequence |
| Chromatogram |
| SGN-ID: SGN-T193384 [Download][View] | Facility Assigned ID: FA0AAD12CD12FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.664 | Expected Error Rate: 0.0373 | Quality Trim Threshold: 14.5 |
Working
