EST details — SGN-E392284

Search information 
Request: 392284Match: SGN-E392284
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180750Clone name: TUS-35-C20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180750 is on microarray TOM1 spot ID 1-1-5.3.17.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C62067 [cLEM-1-F8] Trace: SGN-T83682 EST: SGN-E270309 Direction: 5' Facility: TIGR
Clone: SGN-C180750 [TUS-35-C20] Trace: SGN-T193856 EST: SGN-E392530 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392284Length: 207 bp (826 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E392284 [] (trimmed) ATACGATTAAGACAATCAATTGATGGTAAACCAAAAATATAATATGCACTTGTATTAAAGAACATAGTACCCCTTTCTCATCTAGTTGCTAATCC
ATTGATTAAGCATTGAATCTGCAATCTTTAAGTCATGAGCCTGCTCAGGAGCAGGGGGTCTTCTCCAACAAAAGTCAATCTTTCAATCCTTTGGC
AAAAAGCACTTTCTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392284] SGN-U568957 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193610 [Download][View] Facility Assigned ID: FA0AAD23BB10RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.921 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5