EST details — SGN-E392300

Search information 
Request: 392300Match: SGN-E392300
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180838Clone name: TUS-35-G12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180838 is on microarray TOM1 spot ID 1-1-5.3.17.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64005 [cLEM-4-L14] Trace: SGN-T84356 EST: SGN-E268938 Direction: 5' Facility: TIGR
Clone: SGN-C180838 [TUS-35-G12] Trace: SGN-T193869 EST: SGN-E392543 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392300Length: 313 bp (848 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E392300 [] (trimmed) GCAAAAAAAAAATAACATCTCCATTTTACAGCGCTTCTTACACTTTGAAGAAATTCTCATGTCCATCGATCTCAACCATAGGGTATTCAGAGTTA
CCTCATTGGAGATATCGTTTCCAGAATTTGCATTATTGGATATTACCCCCTTCCAAAACTAAACTTACCTTCTTTTATTTACCTATTTCAACATC
TTTCCCGATTATGCTTGATCCTGTTCCTCCCCTCCTACAAAATCACGCTATGTATGACCCTTCAGAGGAGCTTTTTGGACTTGATGCTGATTTGC
CGCCAAGGAAGGTCATTTCAAGTTCCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392300] SGN-U603634 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193626 [Download][View] Facility Assigned ID: FA0AAD23BD06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0415 Quality Trim Threshold: 14.5