EST details — SGN-E392333

Search information 
Request: 392333Match: SGN-E392333
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181028Clone name: TUS-35-O10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181028 is on microarray TOM1 spot ID 1-1-7.3.17.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C68410 [cLEN-6-C7] Trace: SGN-T88292 EST: SGN-E273596 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392333Length: 394 bp (848 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E392333 [] (trimmed) AGATTCACATTCTTCTCTTATCCTCACATCCAATCGCCACCCCCCAATTCACACTCCAATAACCCATCTCTACTGCTTCCATCCCAATTCCCATT
TCTCCTGATTTTTCCTTCTTCACCATTCCCCCCCTCTTAATTCTCTTTACTCATAATTCATAAAAAAACATGGCTACTGCAGTAAGTGCTGCAGT
TTCTCTTCCTTCATCCAAGTCCACCTCCTTTTCCTCTAGAAACTCCATCATCTCTACAGACAAAATCAACTTCAACAAGGTGCCCTTGTACTACA
GAAATGTGTCTGGTGCTAGTAGATTAGTTTCTATCAGAGCCCAAGTGACCACTGAGGCTCCTGCTAAAGTTGAGAAGATTTCAAAGAAACAGGAG
GAAGGTGTGATTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392333] SGN-U591066 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193659 [Download][View] Facility Assigned ID: FA0AAD23BH05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0122 Quality Trim Threshold: 14.5