EST details — SGN-E392562

Search information 
Request: 392562Match: SGN-E392562
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180946Clone name: TUS-35-K24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180946 is on microarray TOM1 spot ID 1-1-1.3.17.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C62404 [cLEM-21-H5] Trace: SGN-T86596 EST: SGN-E272598 Direction: 5' Facility: TIGR
Clone: SGN-C180946 [TUS-35-K24] Trace: SGN-T193649 EST: SGN-E392323 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392562Length: 565 bp (823 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E392562 [] (trimmed) TTTCTGGTCCCTGTTTGTTCCATCATTCTATCTTGACTTGATTGCATAGATTATCTTTAGGACCTATTTTATCTAGAATTGGAAGATGGATTGTT
TGAAATATCTTTCGAAATTGAATTATAATAAGTGTTAGATCTATTAGAAGTCTACCTGATAGACTACTTGAGATTTGAAGCTTATTGTTATTAGT
AAATTGCCAATGACTGTTGTTGTTATTAAAATGAGTCAGTTTTGATGATATCTTCCCTATGAATTTATTATGATTATTCCTTCTAAAACTGAAAA
GTCAATTTGTTTGTATTGTAATTCCTGGAGGTCTGATATAGAATTGTTTTTTCTTTGTTCATATGATGCTCCAATTGATTTATGATTTCCTTATC
AGTCCTTGTCAGCCATTGAGAAGTTATTCCTCACTGCTTGGCTCTATAGCAAATCCACCTGTTTTCACTGTTGCCTTATTTGAATTCTTACGAAT
ACTACTCTTACCCTAATGTTCTTGGAAAGGGATAGTTTACTCTTCTTATATGTCTTGGTCTATATTAAATTATTCTCGACTCTCTACATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392562] SGN-U597685 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193888 [Download][View] Facility Assigned ID: FA0AAD23BF12FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.898 Expected Error Rate: 0.0121 Quality Trim Threshold: 20.5