EST details — SGN-E393434

Search information 
Request: 393434Match: SGN-E393434
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182226Clone name: TUS-39-A8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182226 is on microarray TOM1 spot ID 1-1-1.1.8.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17813 [cLED-20-O15] Trace: SGN-T53714 EST: SGN-E236197 Direction: 5' Facility: TIGR
Clone: SGN-C182226 [TUS-39-A8] Trace: SGN-T194760 EST: SGN-E399499 Direction: 5' Facility: INRA
Clone: SGN-C182226 [TUS-39-A8] Trace: SGN-T194761 EST: SGN-E393435 Direction: 5' Facility: INRA
Clone: SGN-C182226 [TUS-39-A8] Trace: SGN-T199376 EST: SGN-E398050 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393434Length: 189 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393434 [] (trimmed) AACACTCATATTATAATTATTTCATTTGCATGAATAAAAGATACTAACTTAAGAAAGATATAACAATAAGCTTAAAATTTAAAAGCAACAAAGCA
CGAGTAAATTTCACACTGCTATATTTTTCTGATAAAACAGTTCCTTCACTAAATTCTCTTTTCTCGTTGATCGAAAATCTCCGATGAATAACCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393434] SGN-U580139 Tomato 200607 Build 2 487 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194760 [Download][View] Facility Assigned ID: FA0AAD27BA04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.885 Expected Error Rate: 0.0136 Quality Trim Threshold: 14.5