EST details — SGN-E393447

Search information 
Request: 393447Match: SGN-E393447
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182187Clone name: TUS-38-O17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182187 is on microarray TOM1 spot ID 1-1-8.3.10.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C5882 [cLEC-33-H16] Trace: SGN-T30281 EST: SGN-E207009 Direction: 5' Facility: TIGR
Clone: SGN-C182187 [TUS-38-O17] Trace: SGN-T1708 EST: SGN-E378210 Direction: 5' Facility: Giov. Lab
Clone: SGN-C182187 [TUS-38-O17] Trace: SGN-T194555 EST: SGN-E393229 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393447Length: 558 bp (836 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393447 [] (trimmed) GAGTAACAATATCACAACTTTACAACATATATACTATAGCTAGTTTAAATTTCCACATTAACTTAAATAGTACTCCAAGCAAGCTATTTCAACCC
CCCAAAAATAAAAATACTACTAGTTGTATCAATCTTCTCAAGGAAGTAGAAGTATAACCTATACTAAGTAAACTCTATCTATACACTAAAGCACA
AAATCTCTTCTTTTCTATACTATAATTAAAAAAAGAAGTATATATACTAGAAAGTGTGCTTTAAACTTTTGTCTCCTATGATAGGTTGTATCAAA
TTGGGTCCTCCGACTTGGGCCAAAAGGCCTCACACAATATAAAAGTATCCCTAACTTCCTTTTTTATGTTTTCAGCTATCAATACGAGACTTTGT
GGTATTCATGTTCCAAGATTACCTGTAACAAAATCTGGCAATAATTGAGTTGGAAATCGCTTATTCCCACTTTGAAGATCAATGTTTTCATATCC
CATTCTATTGTAATGACTTCCTATTTCAGGCCTAACTTCCCAACTCATTAGAAAGATAATTTTGTTGGCCCCCCGGGCTGGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393447] SGN-U578683 Tomato 200607 Build 2 61 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194773 [Download][View] Facility Assigned ID: FA0AAD26AH09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0049 Quality Trim Threshold: 20.5