Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E393514

Search information 
Request: 393514Match: SGN-E393514
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182240Clone name: TUS-39-A22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182240 is on microarray TOM1 spot ID 1-1-3.1.8.21 [Order] [Tomato Microarray Database]
See unigene SGN-U578195 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C8004 [cLEC-40-P20] Trace: SGN-T32093 EST: SGN-E210029 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393514Length: 304 bp (850 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E393514 [] (trimmed) CTTTCTTAGTTTACCTAGAATCCAGGTAAGCTCTACTCGGTTTCCAGGAACCCATACATTGTATACTCTACTAGATTTGACATTGCTAGATGACA
TCTAATCCTAAGGTAGGGCGAATAACACTACATATATTGATCTCCCTCTTCCCTTTCTTGATGGGACGTCGGTGAAATAACCTTCAAATGAAAAA
GAAAAAAAAAACGAAATAAAGAAGATTACAAGTCTTGCAAAGGGAAGGATTGAATATTAGCTGACTCAAGTGACCAAATCTTGACGGAGGCAGGA
ACGCTAGCCCCTGTGGCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393514] SGN-U578195 Tomato 200607 Build 2 342 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194840 [Download][View] Facility Assigned ID: FA0AAD27BA11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5