EST details — SGN-E393541

Search information 
Request: 393541Match: SGN-E393541
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182364Clone name: TUS-39-G2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182364 is on microarray TOM1 spot ID 1-1-7.3.8.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C68691 [cLEN-7-G5] Trace: SGN-T88407 EST: SGN-E273711 Direction: 5' Facility: TIGR
Clone: SGN-C182364 [TUS-39-G2] Trace: SGN-T194864 EST: SGN-E393538 Direction: 3' Facility: INRA
Clone: SGN-C182364 [TUS-39-G2] Trace: SGN-T194864 EST: SGN-E398816 Direction: 3' Facility: INRA
Clone: SGN-C182364 [TUS-39-G2] Trace: SGN-T194865 EST: SGN-E393539 Direction: 3' Facility: INRA
Clone: SGN-C182364 [TUS-39-G2] Trace: SGN-T194866 EST: SGN-E393540 Direction: 5' Facility: INRA
Clone: SGN-C182364 [TUS-39-G2] Trace: SGN-T194866 EST: SGN-E398817 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393541Length: 728 bp (830 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393541 [] (trimmed) TTTTAGCTCAGTCTTCTCCTCACAAGATGAATGTAGAAAAGTTGCAAAAGATGGCCGGTTCGGTTAGAACCGGTGGAAAGGGTACCATGAGAAGA
AAGAAGAAAGCCGTACACAAAACAACTACAACTGATGACAAAAGACTACAGAGCACCTTGAAAAGAATAGGTGTCAATGCCATTCCTGCCATTGA
AGAAGTCAACATTTTCAAAGAGGATGTTGTTATCCAATTCAGTAACCCCAAAGTTCAAGCATCAATTGCTGCAAACACATGGGTAGTCAGTGGTA
CCCCCCAGACAAAGAAATTGCAGGATATTCTTCCTCAAATTATTCACCAGCTGGGTCCTGATAATTTGGAGAACTTGAAGAAGTTGGCTGAGCAG
TTCCAGAAGCAGGCACCTGGTGCTGCAGATGTGGCTGCAGGTGCTGTTGCAGCACAGGAAGATGATGATGATGTACCAGAACTTGTGGCTGGTGA
AACTTTTGAAGCTGCGGCTGAGGAGGGCCATACTTCCTGAAGGTTGTGTAATTGAGGTTGAGCAGTCATTTTGGTTGCCATGAGGGTGCTCTCAA
CCAGTGGACTAGTTCTTTTGGAATTCCACCCAGTGTTTGGTATTTGCTTTGGTCTTGATTGATTTCTATTTGCTCCAAGAAAAACTCTAAAGACT
TTTGATAAATAATGATTGGGTTACCACTTCCCTATCAGTCTCGAGTGGTACACAACTATTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393541] SGN-U567984 Tomato 200607 Build 2 36 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194867 [Download][View] Facility Assigned ID: FA0AAD27BD01RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5