EST details — SGN-E393585

Search information 
Request: 393585Match: SGN-E393585
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183393Clone name: TUS-42-A23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183393 is on microarray TOM1 spot ID 1-1-2.1.1.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C73721 [cLER-5-N13] Trace: SGN-T93066 EST: SGN-E279557 Direction: 5' Facility: TIGR
Clone: SGN-C183393 [TUS-42-A23] Trace: SGN-T194910 EST: SGN-E393584 Direction: 3' Facility: INRA
Clone: SGN-C183393 [TUS-42-A23] Trace: SGN-T200230 EST: SGN-E399127 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393585Length: 456 bp (835 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393585 [] (trimmed) AACAATCACAAGCTAAACAAAACCATTAATTACCACTAAGAATCCAAAGAAGTTACAATAATAAAAATCTCTAATTTTCTATCTGAAAAAACTAA
AGTTAATTAATACAAAGAAAGGTAATTACTGTACTTTTTTGGTTAATAAGATGAAAAAGAAGAAAACATAAATAAAAGAAATTTAAACCTCTCCA
TCAATTGAGTTGTAGGTTGAAGGTGAAGAAGCCAATGGAAGTACCTTTACACAAGTAGTAGAGTTTACTTGTATTTGTTCTCTCATTTTGCTCTT
TCCAAGAAATGATATGAATGATCCTTTTTCCTCTATTGAACAAACATCATTCTTGATTACCTTTTTTTCTGCTTCTAATTCTATTAATCTTCTTA
TAAGCTTCTCCTCAGCATCTCTAAGGAACTTGAACTTTGGAGGGGGTGAAGATTTGAGTTTGTTCAACTCATTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393585] SGN-U574248 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194911 [Download][View] Facility Assigned ID: FA0AAD30AA12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.911 Expected Error Rate: 0.0015 Quality Trim Threshold: 14.5