EST details — SGN-E393604
| Search information |
| Request: 393604 | Match: SGN-E393604 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C183489 | Clone name: TUS-42-E23 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183489 is on microarray TOM1 spot ID 1-1-2.1.1.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C14401 [cLEC-7-M24] | Trace: SGN-T25280 | EST: SGN-E201998 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C183489 [TUS-42-E23] | Trace: SGN-T195947 | EST: SGN-E394621 | Direction: 5' | Facility: INRA |
| Clone: SGN-C183489 [TUS-42-E23] | Trace: SGN-T195947 | EST: SGN-E399556 | Direction: 5' | Facility: INRA |
| Clone: SGN-C183489 [TUS-42-E23] | Trace: SGN-T200238 | EST: SGN-E399145 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E393604 | Length: 156 bp (898 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E393604 [] (trimmed)
ACTACGTTATTTTTAGAAACGGAGAAATAAAACTTCATCCGAATACCTTTGCTTTTGAGTATGTGAGAATCTAGACAAGTTTAATCCTCATAGAG
AAGAAAAAAAAATACCATCATTTATTTTTCTTATATTAAATATGAGTGAACCGTGAAGGAA
AAGAAAAAAAAATACCATCATTTATTTTTCTTATATTAAATATGAGTGAACCGTGAAGGAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E393604] | SGN-U578446 | Tomato 200607 | Build 2 | 61 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T194930 [Download][View] | Facility Assigned ID: FA0AAD30AC12FM2 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.910 | Expected Error Rate: 0.0136 | Quality Trim Threshold: 14.5 |
Working
