EST details — SGN-E393705
| Search information |
| Request: 393705 | Match: SGN-E393705 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C183520 | Clone name: TUS-42-G6 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183520 is on microarray TOM1 spot ID 1-1-3.3.2.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C4562 [cLEC-27-O13] | Trace: SGN-T28826 | EST: SGN-E204092 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C183520 [TUS-42-G6] | Trace: SGN-T195030 | EST: SGN-E393704 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183520 [TUS-42-G6] | Trace: SGN-T196022 | EST: SGN-E394696 | Direction: 5' | Facility: INRA |
| Clone: SGN-C183520 [TUS-42-G6] | Trace: SGN-T196022 | EST: SGN-E399257 | Direction: 5' | Facility: INRA |
| Clone: SGN-C183520 [TUS-42-G6] | Trace: SGN-T200294 | EST: SGN-E399256 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E393705 | Length: 109 bp (1118 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E393705 [] (trimmed)
TGGCAGCTTCGGTCCTTTGTGCAACAAGAGCAGCCATAAGAGCAGCACGTGAACAGCTCAAACGTTGGGACAAGCTCGACGAGTCTGCTTCTGAA
TTTTATCTAGATGT
TTTTATCTAGATGT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E393705] | SGN-U582239 | Tomato 200607 | Build 2 | 38 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T195031 [Download][View] | Facility Assigned ID: FA0AAD30BD03RM2 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.935 | Expected Error Rate: 0.0228 | Quality Trim Threshold: 14.5 |


