EST details — SGN-E393737

Search information 
Request: 393737Match: SGN-E393737
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183720Clone name: TUS-42-O14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183720 is on microarray TOM1 spot ID 1-1-3.3.1.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183720 [TUS-42-O14] Trace: SGN-T196055 EST: SGN-E394729 Direction: 3' Facility: INRA
Clone: SGN-C183720 [TUS-42-O14] Trace: SGN-T196056 EST: SGN-E394730 Direction: 5' Facility: INRA
Clone: SGN-C183720 [TUS-42-O14] Trace: SGN-T196056 EST: SGN-E399325 Direction: 5' Facility: INRA
Clone: SGN-C183720 [TUS-42-O14] Trace: SGN-T200335 EST: SGN-E399324 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393737Length: 291 bp (831 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393737 [] (trimmed) TGAAAATGAAGGAACGCGGTATCAGGAAGAAGGTTGTGATGGACTCTGTGTTGATTTTTCACTATTTTCTCCTGTCCAAATAAAAGATGAAGAAG
GGAAACCTCTGCTTTTCTTGGAGTTCTGTAGTTTAGTTTGGAGTCAATTGTTTTGATTCAAAGGTCAATTGCCTGCTAATTTCTGTATACTTGTG
ATTATTGTAATAATAATAATAATAATGTACCAACTTCTATAAATATTTCATTCCCTTACATCTTGAATTCATTAAAGACTGAAGATTTTCATATA
TTGTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393737] SGN-U577579 Tomato 200607 Build 2 90 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195063 [Download][View] Facility Assigned ID: FA0AAD30BH07RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.916 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5