EST details — SGN-E393747

Search information 
Request: 393747Match: SGN-E393747
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183447Clone name: TUS-42-D5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183447 is on microarray TOM1 spot ID 1-1-4.4.2.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C32441 [cLEG-1-I7] Trace: SGN-T64435 EST: SGN-E248372 Direction: 5' Facility: TIGR
Clone: SGN-C183447 [TUS-42-D5] Trace: SGN-T195073 EST: SGN-E399348 Direction: 3' Facility: INRA
Clone: SGN-C183447 [TUS-42-D5] Trace: SGN-T195074 EST: SGN-E393748 Direction: 5' Facility: INRA
Clone: SGN-C183447 [TUS-42-D5] Trace: SGN-T195074 EST: SGN-E399349 Direction: 5' Facility: INRA
Clone: SGN-C183447 [TUS-42-D5] Trace: SGN-T195075 EST: SGN-E393749 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393747Length: 469 bp (853 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393747 [] (trimmed) GCCCAAAGCTCGATGTATAAATTCCATAGTTACATTTTCCAGATACTCCAGTACTCACTTTACAAGCATTGAATTAGGTTAGTTACAAGACAAAC
TGTGCCATTTGGAGTGTACCGAACAGTGAAGAAATCTCAAATTCACTAGTCATGATTTAATGTTCTTTGTCACACCAATGTCCTTTTGTCATTTA
CAGACTTCTTTGATAGCGTTGAGCATTCACAGACATCCCACCATCATCTCCACGGAACTGTCTATACCTGAAGAAATCATCGCTACCTTTGTTCA
ATCTGCCTCTGGGAGGCATAGGTAGCAAAGGTAATGCATTTGGATGGTGACAGATTCCAAGTTTCCCTACAACCGTGACAGTGGTTCCCTTTCCA
GGGCCCTCCCTCCCATTCCAAATGTCACCTTTCGTAAGTTGAATAAATCCGTCCGCAAATGGCAAGCCCCAACACCTTCCCCTCCAGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393747] SGN-U592842 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195073 [Download][View] Facility Assigned ID: FA0AAD30CB03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0135 Quality Trim Threshold: 20.5