EST details — SGN-E393844

Search information 
Request: 393844Match: SGN-E393844
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183065Clone name: TUS-41-D7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183065 is on microarray TOM1 spot ID 1-1-2.4.3.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C67542 [cLEN-19-F3] Trace: SGN-T91338 EST: SGN-E274402 Direction: 5' Facility: TIGR
Clone: SGN-C183065 [TUS-41-D7] Trace: SGN-T195620 EST: SGN-E394294 Direction: 3' Facility: INRA
Clone: SGN-C183065 [TUS-41-D7] Trace: SGN-T200147 EST: SGN-E398849 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393844Length: 225 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393844 [] (trimmed) GTTGCTCGTAATCAATAGAGTGATAAGTAGTTCTTAATTTCTTAATCAGAAGTCTTTCAGGTTTAAATTTCACAAACTCAAATTTTATCGAACTT
TAATACAAATATCGTAAAATCATGGAGTATCATCTGCTAAAGTTGTAGTTGGTGCACCAACCATAACCAAAATGTTCGCCACTTGTTTCTATGTG
TCTCCGGTGATTCAGGACCCCGCAGTGCATACCGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393844] SGN-U572021 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195170 [Download][View] Facility Assigned ID: FA0AAD29CB04RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.924 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5