EST details — SGN-E393865

Search information 
Request: 393865Match: SGN-E393865
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183301Clone name: TUS-41-N3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183301 is on microarray TOM1 spot ID 1-1-6.2.3.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C92804 [cLEX-12-K9] Trace: SGN-T117169 EST: SGN-E304304 Direction: 5' Facility: TIGR
Clone: SGN-C183301 [TUS-41-N3] Trace: SGN-T195348 EST: SGN-E394022 Direction: 3' Facility: INRA
Clone: SGN-C183301 [TUS-41-N3] Trace: SGN-T195349 EST: SGN-E394023 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393865Length: 331 bp (901 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393865 [] (trimmed) CAGTGGTATATTTGTCTTTTTTTCCCTTTCTTAAAATAATATTGGAAATGTATAGATTGGGAATTAAATAAACAACTATTTAGAAAGATTTTGCT
TACAAGGAAATATTAGTTTTCCTCTTTAAAAATGCACACTATTTGTTCTTTGTCTTCCTGTCAAAAATGTCTTCCAAATAACCTCATTCATGGCT
GGATCAAGCATAACTAGATGTCCAACATTGGGCATTTCATGGAACTGTATCCACGAAAGCCTTTCTGCAACGTAACGTTGTAACGTAACAGGTAC
AATCCAGTCTTCGTCACCTTGCCACATGTGGACCGAGCCTTCCCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393865] SGN-U572017 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195191 [Download][View] Facility Assigned ID: FA0AAD29CG02FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0123 Quality Trim Threshold: 14.5