EST details — SGN-E393906
| Search information |
| Request: 393906 | Match: SGN-E393906 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C172770 | Clone name: TUS-14-G8 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C172770 is on microarray TOM1 spot ID 1-1-1.3.20.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C10924 [cLEC-6-K20] | Trace: SGN-T24139 | EST: SGN-E202478 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C172770 [TUS-14-G8] | Trace: SGN-T195231 | EST: SGN-E393905 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172770 [TUS-14-G8] | Trace: SGN-T195232 | EST: SGN-E399055 | Direction: 5' | Facility: INRA |
| Clone: SGN-C172770 [TUS-14-G8] | Trace: SGN-T195673 | EST: SGN-E394347 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172770 [TUS-14-G8] | Trace: SGN-T195673 | EST: SGN-E399054 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172770 [TUS-14-G8] | Trace: SGN-T199552 | EST: SGN-E398226 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E393906 | Length: 192 bp (920 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E393906 [] (trimmed)
ATAATAATTAGAACTTCATACAATACAATATTATTTATTTTACATGCTTTAAGACAAGCCAATATTTTTTAAATTCATCACACAAACAAAGTTAA
TAAATATATATCACGATAGGAACCGATGCATCGAGGTATTTCCGATGAAATTTTCGATCATTTAAATCTTGTGGAGGTGACCCTCTAAATCTCCG
GT
TAAATATATATCACGATAGGAACCGATGCATCGAGGTATTTCCGATGAAATTTTCGATCATTTAAATCTTGTGGAGGTGACCCTCTAAATCTCCG
GT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E393906] | SGN-U580909 | Tomato 200607 | Build 2 | 67 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T195232 [Download][View] | Facility Assigned ID: FA0AAD2BD04RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.901 | Expected Error Rate: 0.0014 | Quality Trim Threshold: 14.5 |


