EST details — SGN-E393920

Search information 
Request: 393920Match: SGN-E393920
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172866Clone name: TUS-14-K8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172866 is on microarray TOM1 spot ID 1-1-1.3.20.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172866 [TUS-14-K8] Trace: SGN-T195395 EST: SGN-E394069 Direction: 5' Facility: INRA
Clone: SGN-C172866 [TUS-14-K8] Trace: SGN-T195688 EST: SGN-E394362 Direction: 3' Facility: INRA
Clone: SGN-C172866 [TUS-14-K8] Trace: SGN-T195688 EST: SGN-E399077 Direction: 3' Facility: INRA
Clone: SGN-C172866 [TUS-14-K8] Trace: SGN-T195689 EST: SGN-E394363 Direction: 5' Facility: INRA
Clone: SGN-C172866 [TUS-14-K8] Trace: SGN-T195689 EST: SGN-E399545 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393920Length: 533 bp (870 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393920 [] (trimmed) GGTTAACGAAACTCTACTGAAAACCCGAATAAAGGAACTTCAAAATTTAACATTTATAACAATACCAAACATAAATCCTCCAAGAAACTAAATCC
ATAAGGAGTAACAAATGCTATAATGCCTACATGAAAACAGAACTGAAAAAATAACATAACCAAAAAGTCTCTCGAAAAAGTTGCTCCAACAACAA
TCTATTAACGATTGGCCTTGGCAACCCTTTCAATCTCGTCCTTCTTCTTAATAACATAACTATTTGAAGAACCCTTGGCAGCATTGATGAATTCA
TCAGCAAGGCACTCAGCTATGGTCTTGATGTTCCTGAAAGCACTCTCACGTGCACCAGTTGTCAGCAAATAAATTGCTTGGTTAACACGACGGAA
TGGAAAAATATCAACAGCTTGACGTCTGACAACACCAGCAGAACCAATACGTGTTGCATCTTCCCTTGGCCCACTGTTGATAACAGCATCAACAA
TGACTTGAATTGGGTTTTGGTCAGTCAACCAATGATATGATCTCCATTGCATGCTTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393920] SGN-U577370 Tomato 200607 Build 2 131 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195246 [Download][View] Facility Assigned ID: FA0AAD2BF04FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5