EST details — SGN-E393928

Search information 
Request: 393928Match: SGN-E393928
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172912Clone name: TUS-14-M6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172912 is on microarray TOM1 spot ID 1-1-3.1.20.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14272 [cLEC-7-G15] Trace: SGN-T25213 EST: SGN-E201931 Direction: 5' Facility: TIGR
Clone: SGN-C172912 [TUS-14-M6] Trace: SGN-T195401 EST: SGN-E394075 Direction: 5' Facility: INRA
Clone: SGN-C172912 [TUS-14-M6] Trace: SGN-T195698 EST: SGN-E394372 Direction: 5' Facility: INRA
Clone: SGN-C172912 [TUS-14-M6] Trace: SGN-T195698 EST: SGN-E399092 Direction: 5' Facility: INRA
Clone: SGN-C172912 [TUS-14-M6] Trace: SGN-T195796 EST: SGN-E394470 Direction: 3' Facility: INRA
Clone: SGN-C172912 [TUS-14-M6] Trace: SGN-T195796 EST: SGN-E399091 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393928Length: 587 bp (859 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393928 [] (trimmed) ATAGCTGCCTGATGAGAGGAAGGGACGCCGGGTACAATCTTTCTTTGGTTCCAGCCCCCCGGTTACACCAAAGCACACCAGTCAACACTGTACTA
TAGCGCTTACACCTGTGAGTTGGCAAAATAATATCGTATGTTAATAAAAGACCTGAGTTGGCGAAAAAAAAAAAAAAAAAAGCTAACGCTAACTA
AGTGTTTAGTTACCATGCCCAAAAGCCCCATGCCTTTCCTGGTTGGATAACCAAATCCAACCGGCGATTTCCTACAAGTTTCTCTTTTTTTTGGG
GGAAGCTAAGAAAGGACAAAGAAAAATGAATATCATGTTTACACCGATCGGATTTCAAAAAGTCCTTCGACCCTTACCTTTTATTCATTCTATGA
TTCTCCTTTCTACCCTTGTTTTGACTACCTGTCTCCTGTCTCATTGGATTGGCTTTGATCCCTACCTTATTATAGAGAGGGTCAAAGGTTCTTTT
TTACTCCATGCCTTACGTGCTCTTTTTAGGCTCTTTGGTTTGGAAATACCTATCCTTCTTCTTTCGCTCGTCGCTTTGGTAGGCGGTTGCAGCAG
CTTTCAAATGGGAGGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393928] SGN-U574554 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195254 [Download][View] Facility Assigned ID: FA0AAD2BG03FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5